Others titles

  • Gene and microRNA Family Annotations
  • Gene Prediction Site and miRNA Family Annotations
  • Gene and miRNA Target Prediction Annotations

Keywords

  • Microrna
  • miRNA
  • microRNA
  • microRNA Sequencing
  • Prediction Site
  • miRNA Profiling
  • miRNA Target Prediction
  • miRNA Cancer

Gene and miRNA Family Annotations

This dataset describes 9991 microRNA sequences and families with annotations for Seed+m8, Species ID, miRBase ID, Mature Sequence, Family Conservation, and miRBase Accession.

Log in to download
Complexity

Get The Data

For getting access to data download links please read and accept the end-user license agreement.
Your Data License
  • Research
    Non-Commercial, Share-Alike, Attribution Free Forever
  • Commercial
    Commercial Use, Remix & Adapt, White Label Log in to download

John Snow Labs Standard End User License Agreement

Last updated:January 20, 2021

This Data Library End User License Agreement (“EULA”) applies to academic researchers, educators, and students using any product of John Snow Labs in John Snow Labs’ Data Library as defined below (hereinafter referred to “you”). This EULA is between you and John Snow Labs Inc., a Delaware corporation (“John Snow Labs”, “we” or “us”).

By downloading and/or using (as applicable) Data Library of John Snow Labs (as defined below), you automatically agree to be bound by, and use it in compliance with, this EULA. This EULA, together with additional terms and conditions and/or policies referenced herein or located on https://www.johnsnowlabs.com and/or conveyed to you by John Snow Labs, is a legally binding contract between you and John Snow Labs.

PLEASE READ THIS EULA CAREFULLY BEFORE DOWNLOADING OR USING DATA LIBRARY.

We may make changes to this EULA from time to time. When we do so, we will revise the “last updated” date given above. The then-current version of this EULA will supersede all earlier versions. You agree that your continued use of Data Library after such changes have been published to our EULA will constitute your acceptance of such revised EULA.

Definitions

“Data Library” means a data library provided by John Snow Labs and located at https://www.johnsnowlabs.com/marketplace/;

“Website” means https://www.johnsnowlabs.com being owned and operated by John Snow Labs.

Important Notice

By downloading and using any product from the Data Library, you acknowledge that the use of Data Library can be subject to the restrictions and controls imposed by United States export regulations.

You represent and warrant that you do not intend to use Data Library for any purpose prohibited by United States export regulations, including, without limitation, terrorism, cyber-attacks, cyber-crimes, money-laundering, industrial espionage, or nuclear, chemical or biological weapons proliferation. Further, you represent and warrant that you are not listed as a denied party on any list governing United States exports.

Eligibility

Our Data Library can be used by an individual.

In the event you have entered into a separate written agreement with John Snow Labs regarding Data Library that contemplates terms that are inconsistent with this EULA, the written agreement shall control and this EULA will not apply to you to the extent inconsistent with such written agreement, or, if such written agreement is contemplated to be in lieu of this EULA, then this EULA shall not apply at all

License Granted

Subject to your compliance with this EULA, as well as any other applicable policies, John Snow Labs grants you non-exclusive, non-transferable, revocable, license to download, access to, modify, and use of, Data Library worldwide (subject to applicable export laws) during the term of this EULA (as described below) under the following conditions:

  • The license can be used solely for research, private study and personal use of Data Library for unlimited period, or unless terminated under this EULA.were made;
  • This license is personal to you and is limited by all terms and conditions set forth in this EULA;
  • The license is granted as a non-commercial, attribution, share-alike and no-derivate-work license as more detailed below;
  • Under the attribution license, you must give the appropriate name of the creator and a copyright notice of John Snow Labs, provide link to this license and indicate if changes
  • Under the share-alike license, you can distribute modified works only under a license identical to this EULA;
  • Under the no-derivate-work license, you can perform only verbatim copies of Data Library, not derivate works or remixes based on it;
  • If the license is used for academic research purpose, the publication shall be made under the open-access, open-source and open-data license.

You can download any dataset from the Data Library from the Website.

Except for your pre-existing rights and this license granted to you, we and our licensors retain all rights, titles and interests in and to our Data Library, all related intellectual property rights, including trademarks (whether registered or pending), domain and business names. Our Data Library is protected by applicable intellectual property laws, including United States copyright law and international treaties.

John Snow Labs is entitled to revoke the license granted at any time at its sole discretion.

License Restrictions

You will be deemed to have taken any action that you permit, assist or facilitate any person or entity to take related to this EULA, your content or use of Data Library. You are responsible for end users’ use of your content and Data Library. You will ensure that all end users comply with your obligations under this EULA and that the terms of your agreement with each end user are consistent with this EULA. If you become aware of any violation of your obligations under this EULA caused by an end user, you will immediately suspend access to your content and Data Library by such end user.

License Restrictions

You will access or use our Data Library solely via John Snow Labs’ Data Library.

Except as otherwise explicitly provided in this EULA or as may be expressly permitted by applicable law, you will not, and will not permit or authorize any third party to:

  1. you cannot reproduce, translate, enhance, decompile, disassemble, reverse engineer or create derivative works of Data Library or its technological features or measures;
  2. you cannot rent, lease, sell, resell, loan, distribute, or sublicense access to any of Data Library;
  3. you cannot circumvent or disable any security or technological features or measures of Data Library;
  4. you cannot use our intellectual property rights without our express prior written authorization or in violation of this EULA;
  5. you cannot use Data Library with an intent to build a competitive product or service, or copy or substantially copy any ideas, features, functions, organization, structure, application program interface, graphics, or user interface of Data Library;
  6. you cannot copy, distribute, or resell any of the information; audio, visual, and audiovisual works, or other content made available on Data Library (collectively, “Content”) or compile or collect any Content as part of a database or other work;
  7. you cannot use any automated tool (e.g., robots, spiders) to access or use Data Library, or to store, copy, modify, distribute, or resell any Content;
  8. you cannot circumvent or disable any rights management, usage rules, or other security features of Data Library;
  9. you cannot use Data Library in a manner that overburdens, or that threatens the integrity, performance, or availability of, Data Library; or
  10. you cannot remove, alter, or obscure any proprietary notices (including copyright and trademark notices) on any portion of Data Library or any Content.

If you breach any of this EULA, the above license will terminate automatically.

Fees and Taxes

This license is for non-commercial use. If you wish to use our Data Library for commercial use, please contact us at support@JohnSnowLabs.com.

Support and Updates

Under this EULA, support services are excluded.

From time to time John Snow Labs can perform updates to our software. If available, such updates may include bug fixes, new features and/or enhancements. You are solely responsible for deploying such updates at your own risk and liability.

Term and Termination

This EULA will become effective as of the date of your order of Data Library and shall be in effect until terminated.

John Snow Labs may suspend or terminate your right to use Data Library, if you or your end user’s use of Data Library:

  1. is in breach of this EULA;
  2. poses a security risk to Data Library;
  3. could adversely impact our systems, Data Library or other customers;
  4. could subject us, our affiliates, or any third party to liability; or
  5. could be fraudulent.

We may also suspend or terminate your right to use Data Library, if you have ceased to operate in the ordinary course, made an assignment for the benefit of creditors or similar disposition of your assets, or become the subject of any bankruptcy, reorganization, liquidation, dissolution or similar proceeding.

You will cease use of Data Library during any period of suspension, or upon termination of this EULA.

All provisions which by their nature are intended to survive termination shall survive termination of this EULA.

Access to Data Library

We do not provide you with the equipment to access Data Library. You are responsible for all fees charged by third parties related to your access and use of Data Library (e.g., charges by Internet service providers).

You are responsible for monitoring your use of Data Library, including payment of all fees and/or taxes related to such access and use. You agree that John Snow Labs is permitted to request and you hereby consent to provide John Snow Labs information related to your use of Data Library for auditing purposes.

You also certify that you are legally permitted to use Data Library, and take full responsibility for the selection and use of Data Library. This EULA is void where prohibited by law, and the right to use Data Library is revoked in such jurisdictions. John Snow Labs makes no claim that Data Library may be lawfully used outside of the United States. If you use Data Library from outside of the United States, you do so at your own risk and you are responsible for compliance with the laws of jurisdiction.

Privacy Policy

We may collect, store and receive personal and other information about you through our Products. Our collection and use of this information is governed by our Privacy Policy available at https://www.JohnSnowLabs.com/privacy/ which may be amended from time to time.

Links and Third Party Content

Data Library may display, or contain links to, third party products, services, and websites. Any opinions, advice, statements, services, offers, or other information that constitutes part of the content expressed, authored, or made available by other users or other third parties, or which is accessible through or may be located using Data Library (collectively, “Third Party Content”) are those of the respective authors or producers and not of us or our shareholders, directors, officers, employees, agents, or representatives.

We do not control Third Party Content and do not guarantee the accuracy, integrity or quality of such Third Party Content. We are not responsible for the performance of, we do not endorse, and we are not responsible or liable for, any Third Party Content or any information or materials advertised in any Third Party Content. By using Data Library, you may be exposed to content that is offensive, indecent, or objectionable. We are not responsible or liable, directly or indirectly, for any damage or loss caused to you by your use of or reliance on any goods, services, or information available on or through any third party service or Third Party Content. It is your responsibility to evaluate the information, opinion, advice, or other content available on and through our Products.

Proprietary Rights

John Snow Labs will not obtain any rights under this EULA from you (or your licensors) to your content.

Data Library is and remains the exclusive property of John Snow Labs and its licensors. Except for the access and use rights expressly set forth in this EULA, no license or other rights in or to Data Library or John Snow Labs trademark(s) and other intellectual property rights therein, are granted to you, and all such licenses and rights are expressly reserved. You will not remove, alter, or obscure any proprietary notices (including copyright and trademark notices) on any portion of Data Library or any Content.

Trademarks

“John Snow Labs,” the John Snow Labs logo, and any other product, business or service name or slogan, whether registered or pending, displayed on Data Library are trademarks of John Snow Labs, Inc. or its suppliers or licensors, and may not be copied, imitated or used, in whole or in part, without the prior written permission of John Snow Labs or the applicable trademark holder. You may not use any metatags or any other “hidden text” utilizing “John Snow Labs” or any other name, trademark or product, business or service name of John Snow Labs without our prior written permission. In addition, the look and feel of Data Library, including all page headers, custom graphics, button icons and scripts, is the service mark, trademark and/or trade dress of John Snow Labs may not be copied, imitated or used, in whole or in part, without our prior written permission. All other trademarks, pending trademarks, registered trademarks, product names and company names or logos mentioned in Data Library are the property of John Snow Labs Inc. and/or their respective owners. Reference to any products, services, processes or other information, by trade name, trademark, manufacturer, supplier, or otherwise does not constitute or imply endorsement, sponsorship, or recommendation thereof by us.

Disclaimer of Warranties

YOUR USE OF DATA LIBRARY IS AT YOUR SOLE RISK. THE PRODUCTS AND CONTENT EACH ARE PROVIDED ON AN “AS IS” AND “AS AVAILABLE” BASIS. WE AND OUR SUPPLIERS AND LICENSORS EXPRESSLY DISCLAIM ALL WARRANTIES OF ANY KIND, WHETHER EXPRESS OR IMPLIED, INCLUDING, BUT NOT LIMITED TO THE IMPLIED WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, TITLE, AND NON-INFRINGEMENT. WE DO NOT GUARANTEE THE ACCURACY, COMPLETENESS, OR USEFULNESS OF THE PRODUCTS OR ANY CONTENT, AND YOU RELY ON THE PRODUCTS AND CONTENT AT YOUR OWN RISK. ANY MATERIAL THAT YOU ACCESS OR OBTAIN THROUGH OUR PRODUCTS IS DONE AT YOUR OWN DISCRETION AND RISK AND YOU WILL BE SOLELY RESPONSIBLE FOR ANY DAMAGE TO YOUR COMPUTER OR LOSS OF DATA THAT RESULTS FROM THE DOWNLOAD OF ANY MATERIAL THROUGH OUR PRODUCTS. NO ADVICE OR INFORMATION, WHETHER ORAL OR WRITTEN, OBTAINED BY YOU FROM US OR THROUGH OR FROM OUR PRODUCTS WILL CREATE ANY WARRANTY NOT EXPRESSLY STATED IN THIS EULA. SOME STATES MAY PROHIBIT A DISCLAIMER OF WARRANTIES AND YOU MAY HAVE OTHER RIGHTS THAT VARY FROM STATE TO STATE.

Limitation of Liability

WE AND OUR SUPPLIERS AND LICENSORS WILL NOT BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, CONSEQUENTIAL, OR EXEMPLARY DAMAGES, INCLUDING BUT NOT LIMITED TO, DAMAGES FOR LOSS OF PROFITS, GOODWILL, USE, DATA, OR OTHER INTANGIBLE LOSSES (EVEN IF WE HAVE BEEN ADVISED OF THE POSSIBILITY OF THESE DAMAGES), RESULTING FROM YOUR USE OF OUR PRODUCTS AND CONTENT. UNDER NO CIRCUMSTANCES WILL THE TOTAL LIABILITY OF US AND OUR SUPPLIERS AND LICENSORS OF ALL KINDS ARISING OUT OF OR RELATED TO YOUR USE OF THE PRODUCTS AND CONTENT (INCLUDING BUT NOT LIMITED TO WARRANTY CLAIMS), REGARDLESS OF THE FORUM AND REGARDLESS OF WHETHER ANY ACTION OR CLAIM IS BASED ON CONTRACT, TORT, OR OTHERWISE, EXCEED THE AMOUNTS, IF ANY, THAT YOU HAVE PAID FOR YOUR USE OF THE PRODUCTS AND CONTENT. BECAUSE SOME STATES DO NOT ALLOW THE EXCLUSION OR LIMITATION OF LIABILITY FOR CONSEQUENTIAL OR INCIDENTAL DAMAGES, THE ABOVE LIMITATION MAY NOT APPLY TO YOU.

Indemnity

To the full extent permitted by applicable law, you shall defend, indemnify and hold harmless John Snow Labs, its affiliates and its licensors, and each of their respective employees, officers, directors, and representatives from and against any claims, damages, losses, liabilities, costs, and expenses (including reasonable attorney’s fees) arising out of or relating to any third party claim concerning: (a) your use of Data Library; (b) breach of this EULA or violation of applicable law by you; (c) any content or the combination of such content with other software, content or processes, including any claim involving alleged infringement or misappropriation of third-party rights by such content or combination; or (d) breach of any obligation or duty you owe to a third party.

Legal Notices

Enforcement of this EULA will be governed by the laws of the State of Delaware, excluding its conflict and choice of law principles. The exclusive jurisdiction and venue for any claims arising out of or related to this EULA or your use of Data Library will lie in the state and federal courts located in Sussex County, within the State of Delaware, and you irrevocably agree to submit to the jurisdiction of such courts. Our failure to enforce any right or provision in this EULA will not constitute a waiver of such right or provision unless acknowledged and agreed by us in writing. In the event that a court of competent jurisdiction finds any provision of this EULA to be illegal, invalid, or unenforceable, the remaining provisions will remain in full force and effect.

Notifications

We may use your contact information to notify you if we have any legitimate interest or if we need to notify you on any important information related to your use of Data Library. We will not send you newsletters unless you expressly consented to such notifications.

Contacting Us

If you have any questions or concerns about Data Library or this EULA, you may contact us by email at support@JohnSnowLabs.com.

Description

The miRNAs conserved to fish have been grouped into 87 families, each with a unique seed region. On average, each of these families has >400 conserved targeting interactions, and together these interactions involve most mammalian mRNAs (Friedman et al., 2009). In addition, many nonconserved interactions also function to reduce mRNA levels and protein output (Farh et al., 2005; Krutzfeldt et al., 2005; Lim et al., 2005; Baek et al., 2008; Selbach et al., 2008). Accordingly, miRNAs have been implicated in a wide range of biological processes in worms, flies, and mammals (Kloosterman and Plasterk, 2006; Bushati and Cohen, 2007; Stefani and Slack, 2008). Critical for understanding miRNA biology is the accurate prediction of miRNA–target interactions. Although numerous advances have been made, accurate and specific target predictions remain a challenge.

All RNA molecules are made up of a sequence of bases, each commonly known by a single letter—‘A’, ‘U’, ‘C’ or ‘G’. These bases can each pair up with one specific other base—‘A’ pairs with ‘U’, and ‘C’ pairs with ‘G’. To direct the repression of an mRNA molecule, a region of the microRNA known as a ‘seed’ binds to a complementary sequence in the target mRNA. ‘Canonical sites’ are regions in the mRNA that contain the exact sequence of partner bases for the bases in the microRNA seed.

When partitioning miRNA families according to their conservation level, it commenced with a high-confidence set of human miRNAs supported by small-RNA sequencing (T Tuschl, personal communication) that shared nucleotides 2–8 with a mouse miRNA supported by small-RNA sequencing (Chiang et al., 2010). Then 100-way multiz alignments were extracted from each mature miRNA from the UCSC Genome Browser and the number of species for which nucleotides 2–8 of the miRNA that did not change were counted.

As an initial pass, those conserved among ≥40 species were classified as mammalian conserved, and those conserved among >60 species were classified as more broadly conserved among vertebrate species. Due to poorer quality alignments for more distantly related species, this procedure misclassified several more broadly conserved miRNAs as mammalian conserved. Therefore, mammalian conserved miRNAs that aligned with >90% homology to a mature miRNA from chicken, frog, or zebrafish, as annotated in miRBase release 21 (Kozomara and Griffiths-Jones, 2014), were re-classified as more broadly conserved.

In addition, miR-489 was included in the broadly conserved set of TargetScanHuman (but not TargetScanMouse) despite having a seed substitution in mouse. Some mammalian pri-miRNAs give rise to two or three abundant miRNA isoforms that have different seeds, either because both strands of the miRNA duplex load into Argonaute with near-equal efficiencies or because processing heterogeneity gives rise to alternative 5′ termini (Azuma-Mukai et al., 2008; Morin et al., 2008; Wu et al., 2009; Chiang et al., 2010).

To annotate these abundant alternative isoforms, all isoforms expressed were identified at ≥33% of the level of the most abundant isoform, as determined from high-throughput sequencing (allowing for 3′ heterogeneity within each isoform). These isoforms were carried forward as mammalian conserved isoforms if they also satisfied this property in the mouse small-RNA sequencing data (Chiang et al., 2010), and as broadly conserved isoforms if they satisfied this property in zebrafish small-RNA sequencing data available in miRBase release 21.

Adhering to the miRNA naming convention, if two isoforms mapped to the 5′ and 3′ arms of the hairpin they were named ‘–5p’ and ‘–3p’, respectively, and if two isoforms were processed from the same arm they were named ‘.1’ and ‘.2’ in decreasing order of their abundance, as detected in the human.

All mature miRNAs were downloaded from miRBase release 21 (Kozomara and Griffiths-Jones, 2014). Those that matched a conserved miRNA at nucleotides 2–8 were considered part of that miRNA family. All miRNAs and miRNA isoforms annotated in miRBase but not meeting the criteria for conservation in mammals or beyond were also grouped into families based on the identity of nucleotides 2–8 and were classified as poorly conserved miRNAs (which included many small RNAs misclassified as miRNAs).

About this Dataset

Data Info

Date Created

2006-10

Last Modified

2016-06-16

Version

Release 7.1

Update Frequency

Irregular

Temporal Coverage

2006-2016

Spatial Coverage

N/A

Source

John Snow Labs; TargetScanHuman Prediction of microRNA Targets;

Source License URL

Source License Requirements

N/A

Source Citation

Vikram Agarwal, George W Bell, Jin-Wu Nam, David P Bartel. Predicting effective microRNA target sites in mammalian mRNAs. Computational and Systems Biologygenomics and Evolutionary Biology; AUG 12 2015.

Keywords

Microrna, miRNA, microRNA, microRNA Sequencing, Prediction Site, miRNA Profiling, miRNA Target Prediction, miRNA Cancer

Other Titles

Gene and microRNA Family Annotations, Gene Prediction Site and miRNA Family Annotations, Gene and miRNA Target Prediction Annotations

Data Fields

Name Description Type Constraints
MicroRNA_FamilyA microRNA or miRNA family is comprised of miRNAs with the same seed+m8 sequence (positions 2-8 of the mature miRNA).stringrequired : 1
Seedm8_SequenceTargetScanS defines a seed as positions 2-7 of a mature miRNA.stringrequired : 1
Species_IDName or Identification of species (from UTR input file).integerrequired : 1level : Nominal
MiRBase_IDMiRBase is a biological database that acts as an archive of microRNA sequences and annotations.stringrequired : 1
Mature_SequenceThe miRNA precursor coming from a genome processed by an enzymatic complex, and only a sequence of approximately 20 nucleotides is conserved, which is the mature miRNA.stringrequired : 1
Family_ConservationMiRNA families in TargetScan 7.1 with conservation cutoffs.integerlevel : Nominal
MiRBase_AccessionMiRBase accession number is the only stable identifier for a MiRBase entry. miRNA names may change from those published as relationships between sequences change. This allows miRNAs to be tracked in the database, allowing names to evolve to remain consistent, whilst providing the user with full access to the data and history.string-

Data Preview

MicroRNA_FamilySeedm8_SequenceSpecies_IDMiRBase_IDMature_SequenceFamily_ConservationMiRBase_Accession
miR-653UGAAACA9598ptr-miR-653UUGAAACAAUCUCUACUGAACC1
miR-653UGAAACA9615cfa-miR-653UUGAAACAAUCUCUAUUGAACC1
miR-653UGAAACA9913bta-miR-653UUGAAACAAUCUCUGUUGAACC1
miR-599UUGAUAA9606hsa-miR-599UUUGAUAAGCUGACAUGGGACA1
miR-1193AGGUCAC9606hsa-miR-1193UAGGUCACCCGUUUGACUAUCC1
miR-802CAGUAAC9606hsa-miR-802UCAGUAACAAAGAUUCAUCCUUGU2
miR-496.2GUAUUAC9606hsa-miR-496.2AGUAUUACAUGGCCAAUCUC1
miR-3096-5pGGCCAAG10090mmu-miR-3096-5pUGGCCAAGGAUGAGAACU0
miR-345-3pCCUGAAC10090mmu-miR-345-3pCCCUGAACUAGGGGUCUGGAG0
miR-345-5pGCUGACC10090mmu-miR-345-5pUGCUGACCCCUAGUCCAGUGC0